Profile

Hello! My name is Ross and I’m a 26 year old scientist living in Cambridge!

My interests include the natural world and natural history (David Attenborough = BAE), cooking delicious foods, EATING delicious foods and trying to keep fit (because of all the delicious foods…)

When I’m not working in the laboratory I spend a lot of my time outdoors, cycling around the beautiful Cambridgeshire countryside and growing my own fruits and vegetables.

Special Skill: I can quote all of Brooklyn Nine-Nine! “Cool cool cool cool cool”

Bad Habits: I work too much (My boss doesn’t agree….)

Weakness: Chocolates (those delicious foods….)

I am a geneticist, which means I study genes, and genes are made up of DNA.

But what is DNA? Briefly, DNA is a long, string-like molecule made up of 4 subunits (A, G, C, T). Each molecule of DNA can be over a 100 million letters long, takes deep breath… AGTCGATGCGTGATGCGCGCGCTATGAT…… you get the picture. And within the sequence of letters is the information needed to make you who you are.

Every one of us has our very own unique DNA (except for identical twins), which is what makes us who we are and is part of what defines us as individuals. DNA is often referred to as the blueprint of life as it contains the instructions to make us (and all other living animals and plants on Earth) who we are.

But where did your DNA come from? This is an easy question to answer, the DNA that makes YOU who YOU are came from your mum and your dad, and both of them contributed half of the DNA needed to make you.

Problem solved? I think not…

DNA is an incredibly impressive molecule, but it has a fundamental problem; it can be damaged, broken and mixed up. And given the precise sequence of letters (A, G, C, T) is important, any damage to the DNA could result in a new born baby having health problems.

My work is to help understand how DNA is damaged, how the damage is repaired and what are the consequences if damaged DNA cannot be repaired in germ cells. Germ cells are incredibly important as they are the only cells in our body that go on to form sperm in men and eggs in women. Germ cells are therefore ultimately tasked with passing genetic information from one generation to the next. It is thanks to these special cells that your parents were able to give you the genetic information that makes you who you are.